A Brief History of Everyone Who Ever Lived

"You know you're a nerd when you read books about genetics with a lot of enthusiasm in your free time." (Me)
"The only good thing about taking a sick day is that when you're too physically and mentally drained to do any real work so you get so bored that you finally read the book that you were meaning to read for weeks." (Me about reading this book for about 3-4 straight hours when I had a particularly bad cold)

Ahhh it's finally 2018! My New Year's Resolution for this blog is to read and review more nonfiction books! I kept a New Year's Resolution last year that I would post more but I ended up posting the same amount as the year before (4 posts in 2016 and 4 posts in 2017). I guess as the years go by I've had less and less time to read, but my reviews have gotten more in-depth and more time-consuming. Seriously, the Game of Thrones review took me a full 2 weeks to write (probably because the book was so long, but still...)

The main reason I'm trying to read more nonfiction books this year is because (I realized that I've only ever reviewed one nonfiction book and that was 3 years ago) I recently went to a college tour at Yale and found myself looking at the books in the bookstore. I found at least ten that I want to get and would've honestly bought them all if books weren't so expensive... So I settled for writing down the titles and looking for them later. I'm excited because a lot of them are about random topics that I'm interested in. There's one about global warming, two about Roman history (apparently I'm really interested in Rome), one about the applications of VR, pathology, human behavior, basically everything.

Also, if you don't know me in real life, I like biology. It's what I want to do. I read a lot about evolutionary biology, but I don't know if I want to study it for a living. This is the first time that I'm reading an organized book about it. Usually it's just articles online or through magazines and not even that often.

The cover (I feel like putting my own pictures of the covers of these books because I have them in my gallery, so now you get the slightly blurry picture I took in the Yale University book store):

Humans are complicated. They make everything complicated, so they have to be complicated themselves.
But, did you know that there were not one Homo sapiens, but several Homo species living around the same time in different parts of the world and that their interbreeding created the modern "races" that we know today? Or that "race" isn't even the best way to classify humans? The way Rutherford puts it: Two African people are most likely more genetically dissimilar than an African person and a European person.
He describes how generations of incest destroyed the Hapsburg family of Austria and contributed to the prominence of genetic deformities like the Hapsburg lip (it's basically an underbite to the extreme) in higher class/ruling families. Politically, it does make sense to wed in the family to keep the wealth all under one bloodline, but genetically, it's one of the dumbest things you can do, because you might get away with it in the first generation, but when the genes for genetic diseases are carried by both parents, their children are more likely to die young or suffer throughout their lives. Basically, genetic variation is good for a family.
I also love the story of a bar in Long Island (he just goes, when you're going to a science conference, all the real science happens at the bar after the talks are over) and how all of the scientists that Rutherford had spent his college years studying their work (I don't remember any names-- sorry!) basically put together a (kind of) drunken bet over how many genes there are in the human genome. This was around the time that the Human Genome Project was still going on, so there was no number yet. The bets ranged anywhere from 2,000 to more than 45,000. It turns out that the human genome only has 20,000 genes. It still sounds like a lot, but compared to an answer like 100,000, it's very little. The person who won guessed 25,000 and she didn't accept the prize money because she didn't want to believe that her "wrong" answer was "close enough".

My thoughts:

I loved this book. It's got a lot of good narrative and really establishes a casual tone that many nonfiction books don't have. I'm surprised, because given the detail of the information he gives sometimes, Rutherford keeps up the conversation tone (BTW: he says pretty explicitly that he claims no lineage to Ernest Rutherford, who was a physicist from New Zealand who discovered the proton). He's telling the story of the history of the field of genetics, and how it relates to works by Darwin and Mendel, and all the other "evolution" people, and he doesn't fail to make it remain a story. I think that's what made it so interesting. It felt like a one-way conversation, and I was ready to commit to learning what the book had to offer.
I personally liked the less academic feel that it had, which made reading it a lot easier, in comparison to a book like Sapiens by Harari, which tries to be informal, but keeps a good distance from the reader. In my opinion, A Brief History of Everyone Who Ever Lived would be an excellent book for a normal person to read and get a general understanding of how the field of genetics works and how it has changed, despite being a relatively new field.
I learned a lot about how DNA works, especially how mutations (mutations are really the root cause of every good and bad thing that has ever happened to humans in terms of their biology) work, and things like that that they barely glossed over in biology class. And now I'm going to share it so now we both have this tidbit of random knowledge about mutations.

Let's say that we have this piece of DNA that codes for a specific protein:

AUGAUUCGACGUACGAUCGA

Basically, there are 3 major kinds of mutations: Addition, Deletion and Substitution

An "addition" mutation would look like this:

AUGAUUCGACGUACGAUCGAAUC

Obviously, the bold part is the part that got added. Now the DNA codes for a slightly different protein (that's probably an amino acid longer) and that protein will fold differently than the originally protein.

A "deletion" mutation would look like this:

AUGAUUCGACGUACGAUGA

Now the DNA is one amino acid shorter and codes for a slightly different protein which will fold differently from the original protein and do something different.

A "substitution" mutation would look like this:

AUGAUUCGACGU(GAU)ACGAUCGA

Instead of the CGU amino acid, the GAU amino acid will cause the protein to fold slightly differently and do something other than what it would normally do.

Also, there's the case of introns. They're sequences in the middle of DNA or RNA molecules that do not code for a specific protein and just interrupt the sequence of the gene. (EXONS are the sequences of DNA that are actually used in coding for a protein, which I'm going to use bold letters to represent in the example)

Let's say that we converted nucleotides (the things that build up the ladders of DNA) to actual letters so we had a sentence that represents a whole gene:

The quick brown fox jumped over the lazy dog.

That's the gene without the introns. The introns would make it look like this:

ADHFDIAGJDAGJAHgThDAUFOADGHFAGKJejhdjkfhadgjijgagdAGJDOAOSD quicDHAFIAHGIDHAGADGNADAadkfjlajkAGHOAGHFHGfjioa brDNODAJGJRWAGANOFSHJHROAJGfdmkafowFHGIIAGKSDGJNfhiasdfnjasfADFHIAFHn DHAIGHDOAGAhgahofdjasfhahofoFHDIAGHdkahgxFDKJG jumpFDOGHFOAHFADFDAFJfhidoagiofaeHFdogdoiajd oFHdajoghaokgjofbgdajfhdGHdkaogver tHFojdajfodnajgbdagDFHAiffheDHFiagdijadoa lakdfaDNAKGhdkaghoagjzjdgiahgiaohgogdsy doHFiadfhafafhdighg.DHioghdojiadjfdjxmfpidmgpagnior

To my knowledge, the purpose of introns is still unknown. Rutherford says over and over that he understands that the field of genetics is a weird thing and you might as well get used to it because it's what makes us the way we are.

((I'm finally finished with my second review of 2018! I have plenty more books to review as I'm probably going to need something or other to distract me from all the random stress that comes with being in school.. But don't worry! The summer is nearly here even though there's still so much snow on the ground!! Happy Reading!!!!))

Simon vs. the Homo Sapiens Agenda

Wow, umm this is a first. The first time I've read a book about a gay romance in my life, and the first time I've started writing a blog post at like 1 AM (usually they're finished by like 1 AM and I have to wait until a decent hour to post them).
Basically, movies are what usually gets me into books in the first place. If I hear that a book is getting a movie and I think the trailer is pretty cool, I read the book. But this was a little bit different. I don't think I've ever seen the trailer for "Love, Simon" yet, even though the movie is coming to theaters in like two weeks. I don't even know where I heard about it, but I did and I ordered the book from the library and it's all kinds of cute, relateable and just feels-inducing (did I just use "feels" in a sentence? I believe a more appropriate term would be butterflies-in-your-stomach).
Yes, if you're wondering, I read the book all in one night and I'm writing the review right afterwards because it's fresh in my mind and I have a lot to say about it. I'll tell you that it's a pretty short book and will probably take you about 2-3 hours to read, but that doesn't make it any less complicated, or any less entertaining.

The cover:

 

Summary: 

Simon Spiers is gay. He knows it and there's no denying it, but he'd rather die than tell anyone. Not until he responds to a Tumblr post by another boy at his school going only by the name "blue" and exchanges emails with him over the course of several months, finding himself divulging more personal secrets than even to his best friends. 

Everything is alright, until Simon forgets to log out of his secret Gmail account one day at school and Martin Addison decides to take pictures of his emails with Blue, mildly threatening Simon that if he can't score a date with his best friend Abby, the whole school is going to know about Simon's secret. 

What ensues is chaos, on the part of Blue and Simon, who struggle to maintain their anonymity with each other and the confronting of their identities that comes with it. While Simon tries to fulfill his part of the deal with Martin without systematically destroying his friend group, he can't help but wonder, who is the boy that he has been discussing the most intimate details of his life with since the summer? Who is the boy with his oddly poetic emails and absolutely perfect grammar? And most of all, are they meant to be together, or is it some cruel twist of fate?

My Thoughts:

I LOVED IT. Partially because I'm a sucker for love stories in general, and probably because I thought it would be way different than how it turned out to be. Somehow, I thought the book would be more of a political statement than an actual love story. (Please don't kill me, but opinions are opinions) But it wasn't. It was just two teenage boys falling in love as awkwardly as they possibly could, while messing up the most stuff in the process, as teenagers in general tend to do. And it was so unapologetically teenager-ish that I loved it even more. There were a lot of situations that I could relate to situations with my own friends, and it was so cute that I just wanted to cry at times. It was like someone finally got it right. Teenagers don't talk like The Fault in Our Stars, throwing sarcastic book references at each other every couple lines, but they're horribly awkward, and seem to make things even more awkward when they're being conscious of how awkward they're being. It's a continuous cycle of awkward. 

Also, Blue's identity is just a what? WHAT? I was mildly disappointed that it wasn't any of the guys that you thought it would be, even when one of them explicitly told Simon that he was bisexual. I understand that it was a mystery that needed to be solved in the most mysterious way possible, but the clues were kind of pulled out of nowhere. Like it was things you would have easily missed (literally one line of one page that you could have easily forgotten about if you were wishing you were with them in every chapter), but I give Bram an immense amount of credit for the ABRAhaM Lincoln thing. My favorite thing is when Simon's going down the list of presidents in his head and goes "Martin Van Buren"....WHAT?! Like that was a moment of extreme terror for him and me too. I swear, if it was Martin all along, that would suck a little. Why would he do the whole thing with Abby if it was really Simon that he wanted? Ick....

Also, can we take a moment to appreciate Simon and just how adorable he is. (Also, y'all should look up Nick Robinson, who's gonna be playing him in the movie, just for science ;) He's so hopelessly a nerd, like he admits that his first celebrity crush was Daniel Radcliffe. It was DANIEL RADCLIFFE of all people (but I think everyone liked him at one point or another), and if that doesn't say what kind of a person he is, he dresses up as a dementor for Halloween. As a seventeen year old boy. It's really cute and just a very pure thing to do. I think that's what his character is in one word: Pure. I guess not really from the point of view of some of the stuff he says, but he always has the best intentions in everything he does and that just makes him even more loveable.

Also, I loved seeing Simon and Blue's emails. They really gave off the vibe of being like text messages, weirdly personal, but just as distant as emails and electronic communication can be. Even Simon cracks and says it to Blue right before they meet up, that he feels like a best friend. He tells him that he's told him things that he hasn't told his actual best friends. But he feels like he's falling in love with a picture. And that's why they need to meet in person. 

I was just as surprised as Simon that no one really cared too much when Martin put up the Tumblr post exposing him. Yeah, as usual some of the guys gave him a hard time, but generally it was alright. I find it funny that he says in the beginning, "Maybe it would be different if we lived in New York, but I don't know how to be gay in Georgia. We're right outside Atlanta, so I know it could be worse. But Shady Creek isn't exactly a progressive paradise." My hometown's a bit like that. It's a lot more progressive, but I can totally see people getting at least a little backlash for being so open about it because for as many left-wing people there are, there are just as many hard right-wing people and I guess you need a balance. Basically, upstate New York is a weird place too.

Age Rating: 16+ 

There's a decent amount of bad language in this one, really enough to convince you that it's about a teenager and his personal problems. It just enhances the casual mood. But seriously, it's not as big of a deal when you go in expecting it. There are a couple derogatory words for gay people used throughout the book, but not much.

Also, I just want to mention that there are some mentions of alcohol and underage drinking, particularly at a Halloween party at one of their friends' house and then again at a "gay bar" that Simon's friend drags him to. But what I barely get is that Simon just strolls into their house, really really drunk, and his parents just ground him for two weeks. I guess it just depends on how relaxed your family is, because that's very strange for me. Oh well. Let's call it cultural differences and move on. 

As far as the romantic content, it's not much. Simon and Blue kiss at the end in that really teenage love story kind of way but it's nothing bad. If anything, this book is innocent. It's cute. It's got no intention of shocking you or pushing any kind of agenda. It's just a love story about two simple boys who are trying to figure out who they are and the best way to deal with it.

((I'm done with love stories for a little while. I'm done. I can't handle the cuteness and the overbearing feeling of me being so hopelessly single... So now onto 2018! I hope it's full of more really good books and more reviews!))