Friday, April 6, 2018

The Martian

You don't even know how excited I am to be doing this review! The Martian is my favorite movie ever. I literally skipped the homecoming dance freshman year because something compelled me to go see this movie on its opening night. And I don't regret that decision at all. I mean, it's two hours of Matt Damon stuck on Mars and cursing at NASA. What more could you want?
And I procrastinated reading this book for so long. You'd think that I'd be ready to read the ORIGINAL SOURCE MATERIAL for what is arguably my favorite movie of all time the moment I heard about it, but it's been over two years and clearly it's not been enough of a nagging for me to do it. Really, I just recently had this conversation with a friend who also really loves this movie and she told me that she read the book and it's hilarious so I should read it too and I was like "You know, I'm just gonna read it. I don't care if I have school the next day or whatever. I'm just gonna read the book and write a review about it because it's amazing and (more) people deserve to know about it."

The cover:

Image result for the martian book

((Also you know what makes me really happy is that while I was searching for a good resolution cover image for this book, I forgot that the new versions that were published since the movie have Matt Damon's face on them and can someone please buy me that???))

Summary:

On the Ares 3 mission to Mars, a severe sandstorm forces the team to quickly stop their lab operations and leave Mars as soon as possible. While trying to make their way back to the ship, Mark Watney is hit by a piece of debris and the crew leaves Mars, thinking he is dead. The thing is, Mark is very much alive (although impaled by bits of the satellite antenna) and now he's stuck on Mars with limited food and supplies, waiting for someone to come rescue him-- or at least to tell people that he's still alive.
At NASA, which is already dealing with the chaos that comes with a dead astronaut, finding out he is alive is even worse of a blow. Keeping him alive and returning him home will be the challenge that they need to devote all of their energy to. 

My thoughts:

By far my favorite line in this entire book comes from somewhere near the beginning, where Mark realizes that he's going to need to grow his own food at some point because there's going to be a point where he's going to run out of prepackaged food and he can either have a crop as backup or starve to death. He literally just goes "I'm going to have to science the shit out of this" ((I actually went into a fit of laughing at that point))
The main thing about this is that even though it's a life and death matter for Mark, he can't help but make jokes. Like sometimes you forget that he might die if he doesn't turn on the airlock this one time or something and that one mistake can either kill him or set him back so many steps that he might as well die. (The team's medical kit has enough morphine for him to take that it would be lethal, so he does joke a few times about killing himself and calls it his "backup plan".) The team's psychologist says later in the book that it's how he copes with things. It makes him feel better to make other people feel better. 
I think that's why I like him so much... I'm like that too. Like I might be dying on the inside but it'll make my day at least 2% better to know that the joke that I told my friend made their day at least a little bit better. And yup, as his astronaut training got more intense, he just kept more aggressively telling jokes and making people happy.

I've been reading up on what people think his MBTI type should be and honestly, I'd lump him in with me as an INFP. At this point I'm even willing to call him an ENFP. He's just xNFP. I mean this kind of optimism is really common among INFP's ((no I'm not talking about just myself, I'm talking about stuff I've read)) and he's got a lot of the stereotypical personality traits like being so emotionally expressive (he really opens up in the mission logs, but that might just be a man who's well aware that he could die any minute trying to record his life so that the people who might find his recordings have something to go off of), childlike, charming, ultra-sarcastic, and cocky. I'm actually leaning towards calling him ENFP because he seems like he connects with others more (somehow I'm getting more of an extrovert vibe from him but it's probably because everyone agrees that the Hermes feels more depressing without him on board) 

Age Rating: 13+ (Looks like me and Commonsense Media actually agree for once):

I'm just going by my own experience but my mom said that she felt pretty okay bringing me (age 13) to see this movie, and after reading the book, it's not that different (content wise). I'm not going to raise the age because of something like Mark running his mouth every couple of minutes. Like that's funny and it's the kind of humor you get used to by the time you're 13 years old. Literally, the first line of the book is just "I'm pretty f---ed." What an opening. (I DO NOT promote using bad language at any time, but sometimes there is no better way to express how you're feeling and I completely get that)
Also apparently one of the tags for this book on Commonsense Media is "Role Models for Boys" and I was questioning that *just a little*. I mean, yes, Mark Watney is an awesome botanist who's able to work through every problem he gets confronted with and doesn't let the constant threat of death and starvation stop him from trying to get off of Mars, but for some reason I don't see him as "role model" material. He'd probably react with something like "Me? Role model? Pfft, no. Boys (and girls too I guess), go into science, it'll be (absolutely) terrifying and you might just end up almost dead on Mars!"
UPDATE: Their little blurb about the "positive role models" in this book is, "Mark Watney, the protagonist of The Martian, is an easygoing "everyman" who survives a deadly situation by remaining calm, thinking through the problem, and devising solutions that depend on his knowledge of science and engineering." Yeah, alright, I see where you're coming from. I guess me and Commonsense Media do actually agree for once....

((See, I'm not leaving my reviews alone! I'm gonna find the right way to have a balance of everything on this blog. I'll figure it out at some point... But for now, Happy Reading!))

Tuesday, April 3, 2018

However, She Didn't Break (Short Story #2)

((Wow, umm I didn't realize how much Blogger hates standard MLA formatting. This is my 4th try at posting this story because it NEVER formatted the right way and I'm angry-- also for everyone who's having the same issues, ctrl + shift + v is the way to go!))
For reference: this is the story that I submitted freshman year to the Scholastic Art & Writing Awards and won a Gold Key at the Regional Level! Definitely my biggest accomplishment as a writer this far!

However, She Didn't Break


It’d been two months, right? Aisha didn’t know how to keep track of the days anymore. The sun has risen and set countless times since her family had abandoned their apartment in Aleppo to go to some country that might as well send them back. At this point her heart was the only part of her body still hoping but her mind knew the fate of her and those around her. They were all going to die and end up washed up corpses on the shore of some beach.
She squeezed her mother’s frail hand in her own as she slept next to her. For a second she thought about jumping off this blasted boat and doing nature’s deed herself. Though despite what the old stories said, Aisha didn’t believe death could possibly be any better than this.
Suddenly her attention was drawn to one of the other women on the small boat. The lady, not much older than her was wailing in desperation, shaking one of her children awake. Except he wouldn’t wake. Aisha cringed at the thought of what would happen next and tightly shut her eyes, but the noise of grievance and loss plagued her head well into the night.

. . .

“It’s those refugees’ fault we’ve got no customers!” my father roared for maybe the third time this week at the end of yet another slow business day. “If people don’t start coming we’ll have to move back to the mainland!”
I really couldn’t blame him for the sudden outburst, but before I could do anything my mother tried to keep him from saying any more. “Hush now, we’ll be just fine.” Her gaze shifted over to me. “Janine, you should head back.” Her voice however gentle it sounded disguised a hint of commanding authority.
I immediately understood and grabbed my jacket, dashing out of the door in less than a minute. As soon as I stepped outside I was hit in the face by a wall of cold sea air, but I had to run home. Night was when those hungry, dirty people struck and it was coming soon.
Groaning and straining against the wind, I heard more sounds that accompanied mine. Chatter in a foreign tongue that held thoughts of remembrance and hope. Barking of the Coast Guard and more chatter. I was forbidden to spy closer, but before I could do anything to stop myself, I had wandered off the paved track and jumped the fence.
The beach that had seen countless nights of my careless play had suddenly been transformed into a heavily secured checkpoint where masses of refugees tried to pass through a hastily erected gate that was their entry into Greece. Taller, stronger soldiers with guns stood in their way, barking in both Greek and English and those who understood retreated a little. I’d never imagined that my humble home where tourists came to sunbathe and indulge in Mediterranean delicacies would become a struggle between two equally frightened and frantic groups of people.
For a moment I was distracted by the rustling of gravel further down the slope. I feared that someone would find me and drag me to a police station to find my parents. As the rustling got closer, I began to hear labored breathing and hid further behind the boulder, knowing it was my only barrier against whoever was there.
I saw a face, but not with the angles of a soldier’s. It was considerably rounder and more soft, perhaps a woman’s face. She wore the black veil that the women of her country wore, though it wasn’t close to enough to hide streams of thick hair that flew across her face. And her eyes, they were wide in terror as she fought to stand on the slippery rocks.
Shouting from below caused her to divert her attention to the sea of people. The girl called back in her unfamiliar language that I couldn’t understand, voice hitching a little. Within a few minutes she had run down the slope with the speed of unsure footsteps to join her people.
Suddenly feeling heavy from the nerves of the experience, I slowly got to my feet and staggered up the cliff, hoping I wouldn’t fall. Once or twice I turned around to see if the girl was still following me but my eyes failed to focus. Trying to affirm myself that nothing bad happened I climbed over the railing once again and ran the way home faster than I normally would.

. . .

By morning I was sure the chaos would die down. If anything I wanted to properly meet the girl. Half wandering in thoughts, I almost flew out of the house in a desperate hurry to get to the beach with nothing in my hands but a few meager coins to buy bread.
Fresh rolls in hand, I slowly crept down the slope, unsure of what would greet me at the bottom. Though my stomach was growling with the smell of rolls in my hands, I stopped myself from taking a bite. These were for her. Yeah, as if some part of me believed I could win a person over with bread.
Not much to my surprise, there were people sitting on and around the overturned boat. No one spoke, but when they saw me approach, inquisitive heads turned with fear ridden, sleepless eyes inspecting me.
Suddenly my gaze locked on her figure, bent over something small in her hands. Even if I didn’t see her face, I had a really good feeling it was her. I made my way through the crowd with confidence, not holding a single wary gaze, but keeping my eyes only focused on her.
The girl slowly turned to look at me, shoving the small object she was toying with earlier into her dress. Her gaze was harder than that of any girl I’d met before. “Why are you here?” she curtly asked in heavily accented English. “And why do you have all that bread?” As if to affirm herself with partially true assumptions the girl kept rambling on and on. “Of course you’re going to give me bread because I’m a poor girl and you feel bad for me. Your people don’t care about us so why should you?”
I was hurt by every hiss of sarcasm that came out of her mouth but I mentally excused her. I managed a smile and offered the bread to her like a peace laurel. “Keep it.” When she didn’t take it, I pressed on. “It’s for you. Well, all of them are. They’re a little gift.”
She hesitantly took one and inspected it before taking a bite. All of it spoke of home and nights indulging in the pride of enjoying wonderful food. “It’s amazing,” she mumbled. “It’s truly a gift from God,” the girl said louder, looking directly into my eyes for once since we began talking. She took the rest of the rolls from my hand and shouted back to the people behind her. Soon after, many were lining up to get a roll from her, splitting it in halves and quarters with those around them.
As I watched these people eat, I wondered if this was their first taste of good food in a while. What I’d uncovered wasn’t a group of uncivilized humans bent on survival, but people who cared for one another because they knew that each breath and bite of warm food they took may very well be their last.

. . .

Over the next week I kept bringing food, lying to my parents that I was keeping myself busy and studying. I met the girl every day —she told me her name was Aisha— and we talked about pretty much everything, consciously avoiding the topic of the Syrian Revolution and Islamic State.
However through these long conversations I itched to know what it felt like to have to go through what she had. I also wanted to invite her to the restaurant and make her some good Mediterranean food, so I decided to combine them both in a cute forbidden midnight rendezvous.

. . .

I led her into the dimly lit restaurant blindfolded so she wouldn’t be able to see the wonderful meal I had prepared for her. Trying to guide Aisha through the rows of tables and chairs I personally felt like I was blindfolded more than her, though I was able to manage getting her into a chair.
“Janine this is weird,” she complained but I audibly shushed her. “Will I like the surprise?” she asked like a small child.
I tried to reassure her that she’d love it. I brought out the most beautiful set of china we had, filling it with tea and putting a cup beside her plate. I hated myself for thinking this way but it felt like I was making a peasant girl feel like a princess for a night and that eased my conscience a little. Slowly I untied her blindfold and let Aisha take in the wonderful place that was my family’s restaurant. “It’s kind of dark in here, but if I turn on any more lights the blinds wouldn’t be able to contain them,” I confessed.
“So no one knows that you’re here? Or that I’m here?” she asked, the fact that I had done this without my parents’ consent being the only thing that bothered her.
“Not a soul.”
An awkward silence broke between us. I took a seat next to her, watching the girl almost hungrily devour the simple hummus and bread I brought out. I was suddenly reminded of my purpose.“What was this city of yours like?” I asked, hoping I wouldn’t hurt her. She’d already been through so much that I didn’t want to pry if she wasn’t comfortable.
“It didn’t look anything like this. It’s a huge city and without a guide who knows what they’re doing you can get pretty lost.” Small beads of tears began to form on the corners of her eyes at the thought of her old home.
I imagined living in a place with so many people for a second. It’d be much too crowded for me, but it was home for her. “How did your home look?” I asked, feeling bad to interrupt her, but we were a little short on time.
“I guess our apartment was a little small, but it was enough,” Aisha started. “I didn’t like having to leave not because of the inconvenience, but because I’ve lived in the same place since I was born. You know, sometimes I’d go on the terrace of the building and just stare at the sunset. One time I actually fell asleep up there and my parents went crazy trying to find me.”
I chuckled with her at the small memory, observing how she smiled and how her chest heaved up and down through her barely tight dress as she laughed. I was a little sad that it brought me to the question I dreaded asking her. “Did you know when you would have to leave?”
Her smile melted instantly and she grabbed my covered arm as if to reassure herself that I would protect her. “I didn’t realize it when people started to disappear,” Aisha choked out. The tears that seemed small drops on her eyelids moments before were a raging torrent of water and mucus, dirtying the eyes I once saw as beautiful to make them muddy and unclear. “It started when some of my friends stopped coming to school and I didn’t know why. I thought they got sick or something and that they’d come back but I didn’t know about the riots and what was going on. Eventually the fighting got so bad that they just closed down the school and we were forced to stay at home,” she managed to say between sobs. “Then one day we got the courage to sneak out with a friend on a secret trail and leave. Leave the place that’s seen all of me and provided a roof over my head for sixteen years.”
Aisha held onto me for some time longer, not saying anything. She was lost in her own world of the suffering she’d seen and felt all around her. I was at a loss for what to do or say in response. I knew it would have been a horrible feeling, living out daily life as if nothing was happening and also being wary that if someone caught you inside they might kill you.
My hand eventually made its way to hers, entwining our fingers in a gesture of reassurance. “You’re safe here. I promise you that you’ll never have to feel anything like that ever again.” Our eyes made contact, hers holding the fear that confused her and mine holding a warm feeling. You’ve made it this far, I thought. You’re unbreakable my friend.
The door to the restaurant flew open and we both ducked, looking for the safety of the table. “Janine!” someone shouted and I knew who it was. I was in so much trouble, oh so much deep trouble.
Aisha turned to me, whispering, “Do you know them?”
“I wish I didn’t right now,” I whispered back.
The slight exchange we had had given away our hiding place. With a harsh tug, my leg was used to wrench my body out from under the table. I was faced with the fury of my father, his face contorted in anger.
“What the hell are you doing here making food at two in the morning?” he screamed, completely furious. At this point it really didn’t bother me too much that my Papa who rarely got angry was venting out his frustration at me. I hoped that he wouldn’t notice Aisha down there under the table. I think I spoke too soon because he’d seen her rear end poking out from underneath the tablecloth and flipped the whole thing over, shattering china and spilling food everywhere. “Who is she?” he roared.
“My f-friend,” I stammered, almost turning white.
“What did I tell you about going down to the beach? Her people are dangerous! They might really hurt you if you get too close. How long has this friendship been going on?”
“A week,” Aisha said softly. “But I assure you my people—”
“Silence girl! I’m talking to my daughter!”
“She’s right. It’s been a week,” I said, regretting all of it but trying to hide the fact that I felt there was nothing wrong with what I was doing. I thought if I pretended to act ashamed he might let Aisha go. Yes, none of this had to do with me. It was all for her.
My father nodded and harshly dismissed her. “Go. Leave us and never come here again,” he commanded. Aisha did just that. Suddenly a sharp pain erupted in my cheek, making my eyes water and sting. He’d struck me hard on my face. “Let’s go home,” he barked and I obeyed.

. . .

I was forbidden to leave the house the next day. My parents left early in the morning and locked the doors. However much I felt like I deserved it, some part of me felt like I had to go see Aisha again and apologize for what happened. I didn’t have my wits about me and made some really hasty decisions.
Barely thinking I opened the kitchen window and popped the screen out, hoping I would be able to fit through such a small opening. I did and finally after about ten minutes of intense thrashing fell out onto the bushes that lined the side of our house.
I ran straight for the beach, not caring that I was wearing no shoes or that it was cold outside.
To my amazement there was a giant ship standing near the beach. In all my years of living on this island, I’d never seen a ship that big. I searched for Aisha as I ran down the slope, unable to find her amongst the sea of people. I whimpered in pain as the soft soles of my feet were scratched by the jagged pieces of rock, though it was tolerable in comparison to the breaking of my heart.
I suddenly caught sight of her veil as she stood in line to get on the unfamiliar vessel and ran as fast as I could, shoving aside people and not bothering to apologize.
“Aisha!” I shouted her name, knowing it was no use. “Aisha please look at me!” My voice was at its breaking point, but I kept shouting.
I lightly pulled on her dress enough that she’d turn around and notice me. When she did, I made sure to make my apology brief. “I’m sorry about what happened last night. I didn’t know that my parents would catch on,” I apologized, waiting for her response.
Aisha spent seconds that felt like eternity just staring at me. “Janine, that was the best night I’ve had in a very long time. You know, I’ll miss you a lot when we reach Germany. I promise I’ll always keep thinking of you.”
My eyes teared up at her last sentence. In a gesture of pure love I threw my arms around the smaller girl and embraced her tightly. I only wanted to break the silence when we separated. “Have an adventure, okay?”
She nodded and the line started moving. I watched her figure get smaller and smaller until it disappeared completely. You know, that girl was impressive. Very impressive. She’d been through so much in such a short amount of time while keeping her head intact. I had to admire that in however much adversity she’d faced, Aisha had come out slightly bent, but not broken. It took a will with the flexibility of elastic and strength of iron to do something like that.

I feel like stories like this are especially needed in this world where people are quick to judge those that look different and act different from them and think that they'll hurt them. We are all humans... how hard is it to understand? 

Happy Reading!

Sunday, April 1, 2018

Summer Dance (Short Story #1)

To kick off my string of original posts, I want to share something really really recent (like I wrote this in November 2017 for a competition) that I'm proud of (even though it didn't win), just because I wrote something that I wanted to write and that it turned out better than I expected. I mean, there are some places where I'd like to improve it now that it's been a few months and I've moved on to other works, but I just want to share the version as of 12/4/2017.

Also on that note, something I wanted to share about finishing stories: I had this English teacher in 8th grade, which might or might not have coincidentally been the same year that I started writing seriously (if you're reading this, thank you for all of your support! It's been over three years, but I haven't forgotten yet!) who said to our class, "Good writing is never done, it's just due" and that's something I think about a lot, especially when I send my work to competitions.

Anyways, on to the story: This is Summer Dance, the story of a violinist who is a little down on his luck playing for cash, and a dancer with some time to kill before her show.


Summer Dance


Bene could have sworn that his evening could not get any worse. He was struggling like an amateur to play a dance that he had practiced for this festival for weeks. He could probably blame it on the humidity or his violin being uncooperative, but he knew that it was entirely his fault. His runs were sloppy and he could not seem to keep the beat in his body. As he felt the music slip away from him, he could sense the disinterest of others forming a bubble around him. Obviously no one wanted to give money to a musician who could barely even play his music.
He mentally scolded himself for thinking so critically. It was a festival day, and the midsummer festival at that. He had no right to spoil this night of music and dance for himself.
A young girl stepped casually towards him, seemingly from out of nowhere. She appeared in a dreamlike state, lost somewhere in her own world. She tripped into his wire stand, causing it to fall down with his sheet music. Bene stood in awe as his papers scattered on the ground, some flying away in the hot summer wind.
The girl stood clumsily, making quick, apologetic eye contact with him before running to pick up the flying papers. She refused to say a single word throughout, not even ‘I’m sorry’. A thick, awkward silence hung around them as Bene felt embarrassed that the girl was making all the effort to gather his papers and he was just standing there in shock.
She handed them back to him in a neat stack, smiling all the while. It was the first time that he had really gotten to see her properly as he took the music. He looked her up and down as he pretended to count the pages. Her figure was definitely strong, but light. Her legs were smooth and well-defined, save for a large scar below her knee. He could never bring himself to admit it, but she was beautiful. She was one of the most beautiful girls he had seen in a long time. Her physical appearance was starting to bother him as they gazed into each other’s eyes, staring soul to soul for just a moment. He looked away shamefully, thinking it would be too creepy on his part, seeing as he was significantly older than her. “I’m so sorry that I did that to you,” she said, breaking the silence. “I usually don’t do that to people, I don’t know why it happened.”
Bene put a hand on her shoulder, finding it difficult to hold his violin and music all in his other hand. He wasn’t even smiling, even if something about the way she spoke made him deeply want to. She was a stranger. There was no reason to get all happy around someone he didn’t even know. “It’s fine. It’s only my music.” He placed it back on his stand and took up his position, deliberately watching her as he tuned one pitch by ear.
To his surprise, the girl sat down on the dirty ground, watching him shuffle his fingers with growing interest. “What’s your name?” she asked when he had finished tuning.
“Does it really matter? It’s not like we’re going to see each other again.”
“No, but you can come see the ballet tonight and at least feel happy that you know one of the dancers and that one of them knows you.”
So his intuition had been right after all. She was a dancer “Fine,” he relented, feeling sorry for her and the trouble she had gone through to collect his papers. Giving his name was really the least he could do. “My name is Bene.”
She immediately straightened her back to introduce herself. “I’m Melody.” She cocked her head to the side, looking at his face from another angle. “Well you look like you’re not having a fun night.”
He sighed, playing random notes to occupy himself as he thought of what to say. It wouldn’t be fair to dump all of his problems on a girl he had just met, but she had asked. “I usually play for cash, but I guess I kind of suck right now.” Bene gestured widely at the crowd around them with his bow and stuck out his tongue in frustration.
“Then play for me,” Melody suggested, standing up. “I can be all of your adoring spectators and honestly, if one person likes it, almost everyone will.”
He couldn’t see anything to lose from it. It was free entertainment and all the more reason to practice his music so he could get it right at least once in front of a decent crowd.
Bene lightly touched his bow to the string and the first high A screeched as if to mock his sudden fear of performing. It settled a little as he moved his bow with more pressure and let the note take shape. His hands felt stiff as he knew that they shouldn’t, but his nerves were working against him and there was no way to let his fingers glide over the fingerboard the way he was sure they should. Out of the corner of his eye, he finally noticed Melody standing so close to him. She smiled and motioned for him to relax.
Although he had only just played one note, making it sound strong and in tune had completely exhausted him. He looked for Melody’s smile again, hoping that she would agree to leave. The last thing he wanted was to bear the shame of being unable to perform on a night where people came solely seeking performers and their arts.
Even though he looked for the comfort of running away, he saw Melody standing there only a few feet away with her dancer’s grace, lightly tapping her foot to a beat that he could not discern. She glanced up at him briefly before looking back down again to keep her foot tapping at the same speed. The metered rhythm calmed him, bringing back structure to their dance.
Bene felt all of his impulses leave him as he took one large breath, launching into his dance at the speed of her feet. He soon found himself straying from the counting and settled between the beats as he prepared for his attempt on the high A yet again. As he dragged his bow against the string, he pressed down a little harder with his other hand and felt the note resonate more. Although he wasn’t too satisfied with it, it would have to do. At least for now.
Moving on, he felt his fingers gradually loosen as he moved his whole body to the subtle measures of three. Where he stumbled over notes, he felt something invisible encouraging him to keep going. He would have to thank this invisible force later for keeping his perfectionism at bay.
His eyes strayed from the papers below to see Melody taking her starting position, letting her arms reach out almost towards him as she stood with her feet at angles. Through the haze, he was convinced that she was ready to make some kind of leap. It was no leap but a step in his direction and then to the left and to the right, moving her arms in some nonsensical dance with herself as he fought to keep playing to their original tempo.
Melody saw him struggling to keep the beat as she moved around. With a chuckle, she finally understood how much of a distraction she was being. Still, she sped up her footwork. Bene responded by playing faster, although his fingers were beginning to cramp from sliding all over the fingerboard. Every note spilled out of him, forming a chaotic melody that he suspected was far different from what had been written on the paper by some dead man hundreds of years ago. Just stop dancing, he willed, hoping that Melody would let him take the tempo that he wanted and keep his fingers from falling off. She stopped and tapped her feet roughly on the ground, giving him momentary relief. He found himself settling into their original moderate beat without any complaint. In an instant, she had completely discarded that tempo to spin around at a completely new pace. She threw her arms out like it was best night of her life as they both wrapped themselves in the music and let themselves be free.
As the minutes went by, Bene was becoming increasingly convinced that he was dreaming. Even in the stickiness of the intense summer humidity, he moved like he had never felt music before to the beat of this girl who had danced so beautifully into his life. From every angle, he felt that it was too good to be real. For a moment, Bene had the haunting feeling that any minute he would wake up again in his cold bed, completely alone. He furrowed his brows in response and continued to push out every note that he could hit.
Melody reached out to jab at him playfully, shaking him abruptly from his thoughts. “You’re too stiff,” she teased as Bene fought to keep the tempo up to where she had set it before. Just as swiftly as she had appeared in front of him, Bene could feel that she had wedged herself between his back and the wall to smack him on the back like his teacher. “If you relax, you can probably play at the speed of lightning if you try really hard.”
With that, he threw down the tension from his shoulders like a horse, straightening and allowing his bowing hand to drag across the strings with more intensity as he felt himself take control of the beats. He shifted to accommodate the change in speed as Melody resumed her part in their dance. It wasn’t really a dance in the sense of performance, but a harsh comparison of the fluidity in her motions to the way he stumbled over notes and runs as he tried to make a nineteenth-century dance sound the way he thought it should.
Bene felt the tone of the last note slip out of his hands as he could only be glad that the piece was over. His shoulders slumped as he felt the weight that he had previously shrugged off return and weigh him down further. Melody’s enthusiasm had completely worn him out. In an instant, his knees buckled and he felt himself fall to the ground in exhaustion.
“Wasn’t that fun?” Melody asked happily. Somehow she was still jumping around like a child. This whole ordeal was unbecoming for a dancer of her stature, having performed in prestigious opera houses and concert halls around the country. If anything, Bene deeply felt that this performance was unbecoming of himself. He had never earned less than a hundred dollars per performance at a gathering like this. Still, Melody clapped like an adoring audience member, shouting, “Bravo! Bravo!” She gave him a standing ovation like he was a famed soloist in some concert hall far from here. Even though she didn’t really understand much about violins or their music, she was sure that this was a performance she would never find anywhere else.
“Why are you making fun of me?” Bene muttered to himself, not speaking to anyone in particular. He felt himself on the verge of tears and shoved his violin in her face, hiding himself.  “If it was good, people would have stopped by to listen. I couldn’t even make a single dollar off of this nonsense.”
Melody took the violin and set it down on the ground next to him. She didn’t want to believe that her dancing had caused him any pain. He looked like he was having fun, so she had gone with it. She put one hand in his perfectly gelled hair, trying not to ruffle it around too much as she thought of a way to make him feel better. “It was only a joke,” she said soothingly, still stroking his hair. Watching Bene start to cry made her feel even worse. “I just thought that you wanted some company. God knows it’s never fun to perform alone.” She felt herself tearing up as she fled like a child, afraid that she had really hurt him in their small game.
Bene spent the next few minutes in the lingering blurry haze after his crying fit, but he saw Melody run away, possibly crying as he had been. She had quickly become another face in the crowd as he struggled to get his bearings. Bene could have sworn that he had dreamed the events of the last two hours, but even if it was so, she had been the most beautiful thing his mind had created in a while. He knew that he would be waiting for the next hot summer night when they would meet again, whether in this world on in his own.
Still, something about their experience stuck in his mind. It was unlike any performance that he had partaken in before. Theirs was technically flawed, but he felt the hole in his chest of where his heart had been connected to hers. Bene stood up on shaking legs and picked up his violin, wondering where to go from here. His head ached and his vision was getting foggy, but he had to keep moving.
After a few minutes of aimless wandering, he found himself at a long queue for some performance. From the amount of people that had gathered around the ticket booth, it had to be a really big deal. He couldn’t read the entire title and the only word he could vaguely make out was ‘ballet’, but Melody’s words about the ballet were the first thing that came to mind as he gave up the few dollars in his pocket for a ticket.
As the chattering of the crowd died down, the curtains opened and the orchestra began playing the same festival dance he had heard for years. He wondered what exactly was so special about this time, but did not leave. Maybe in this case, heartache caused by music could only be remedied by more music.
A single young girl stepped on stage, wearing a bright yellow mask that glittered in the spotlight. Bene couldn’t help but see Melody’s shape in her. He rubbed his eyes, looking at her again. He was still unable to shake the unmistakable resemblance to her, with the same blotchy scar on her knee. He was certain that it was her.
She slowly lifted the mask from her face, letting it fall to the ground. They locked eyes from across the arena. He felt inclined to look away, but her warm eyes kept him watching as she took the same starting position as Melody had when they had danced. The girl began moving  as the music picked up, seemingly never breaking eye contact with him. Bene felt his heart drop as he wondered if maybe he hadn’t gone as crazy as he had originally thought.

NOTICE

I've got a (mildly) important announcement to make: I'm gonna be using this blog as a writing portfolio as well as a collection of book reviews. That means I'm adding my own original short stories and poems to the mix of stuff I post here. It doesn't mean that I stop posting book reviews, but as they become less frequent, I'll still have things to post, and sometimes they'll be based off of a book I read or something, but a lot of the time they'll be completely original works.

Happy Reading and thanks for looking at this announce!

Friday, March 23, 2018

A Brief History of Everyone Who Ever Lived

"You know you're a nerd when you read books about genetics with a lot of enthusiasm in your free time." (Me)
"The only good thing about taking a sick day is that when you're too physically and mentally drained to do any real work so you get so bored that you finally read the book that you were meaning to read for weeks." (Me about reading this book for about 3-4 straight hours when I had a particularly bad cold)

Ahhh it's finally 2018! My New Year's Resolution for this blog is to read and review more nonfiction books! I kept a New Year's Resolution last year that I would post more but I ended up posting the same amount as the year before (4 posts in 2016 and 4 posts in 2017). I guess as the years go by I've had less and less time to read, but my reviews have gotten more in-depth and more time-consuming. Seriously, the Game of Thrones review took me a full 2 weeks to write (probably because the book was so long, but still...)
The main reason I'm trying to read more nonfiction books this year is because (I realized that I've only ever reviewed one nonfiction book and that was 3 years ago) I recently went to a college tour at Yale and found myself looking at the books in the bookstore. I found at least ten that I want to get and would've honestly bought them all if books weren't so expensive... So I settled for writing down the titles and looking for them later. I'm excited because a lot of them are about random topics that I'm interested in. There's one about global warming, two about Roman history (apparently I'm really interested in Rome), one about the applications of VR, pathology, human behavior, basically everything.

Also, if you don't know me in real life, I like biology. It's what I want to do. I read a lot about evolutionary biology, but I don't know if I want to study it for a living. This is the first time that I'm reading an organized book about it. Usually it's just articles online or through magazines and not even that often.

The cover (I feel like putting my own pictures of the covers of these books because I have them in my gallery, so now you get the slightly blurry picture I took in the Yale University book store):




Humans are complicated. They make everything complicated, so they have to be complicated themselves.
But, did you know that there were not one Homo sapiens, but several Homo species living around the same time in different parts of the world and that their interbreeding created the modern "races" that we know today? Or that "race" isn't even the best way to classify humans? The way Rutherford puts it: Two African people are most likely more genetically dissimilar than an African person and a European person.
He describes how generations of incest destroyed the Hapsburg family of Austria and contributed to the prominence of genetic deformities like the Hapsburg lip (it's basically an underbite to the extreme) in higher class/ruling families. Politically, it does make sense to wed in the family to keep the wealth all under one bloodline, but genetically, it's one of the dumbest things you can do, because you might get away with it in the first generation, but when the genes for genetic diseases are carried by both parents, their children are more likely to die young or suffer throughout their lives. Basically, genetic variation is good for a family.
I also love the story of a bar in Long Island (he just goes, when you're going to a science conference, all the real science happens at the bar after the talks are over) and how all of the scientists that Rutherford had spent his college years studying their work (I don't remember any names-- sorry!) basically put together a (kind of) drunken bet over how many genes there are in the human genome. This was around the time that the Human Genome Project was still going on, so there was no number yet. The bets ranged anywhere from 2,000 to more than 45,000. It turns out that the human genome only has 20,000 genes. It still sounds like a lot, but compared to an answer like 100,000, it's very little. The person who won guessed 25,000 and she didn't accept the prize money because she didn't want to believe that her "wrong" answer was "close enough".

My thoughts:

I loved this book. It's got a lot of good narrative and really establishes a casual tone that many nonfiction books don't have. I'm surprised, because given the detail of the information he gives sometimes, Rutherford keeps up the conversation tone (BTW: he says pretty explicitly that he claims no lineage to Ernest Rutherford, who was a physicist from New Zealand who discovered the proton). He's telling the story of the history of the field of genetics, and how it relates to works by Darwin and Mendel, and all the other "evolution" people, and he doesn't fail to make it remain a story. I think that's what made it so interesting. It felt like a one-way conversation, and I was ready to commit to learning what the book had to offer.
I personally liked the less academic feel that it had, which made reading it a lot easier, in comparison to a book like Sapiens by Harari, which tries to be informal, but keeps a good distance from the reader. In my opinion, A Brief History of Everyone Who Ever Lived would be an excellent book for a normal person to read and get a general understanding of how the field of genetics works and how it has changed, despite being a relatively new field.
I learned a lot about how DNA works, especially how mutations (mutations are really the root cause of every good and bad thing that has ever happened to humans in terms of their biology) work, and things like that that they barely glossed over in biology class. And now I'm going to share it so now we both have this tidbit of random knowledge about mutations.

Let's say that we have this piece of DNA that codes for a specific protein:

AUGAUUCGACGUACGAUCGA

Basically, there are 3 major kinds of mutations: Addition, Deletion and Substitution

An "addition" mutation would look like this:

AUGAUUCGACGUACGAUCGAAUC

Obviously, the bold part is the part that got added. Now the DNA codes for a slightly different protein (that's probably an amino acid longer) and that protein will fold differently than the originally protein.
A "deletion" mutation would look like this:

AUGAUUCGACGUACGAUGA

Now the DNA is one amino acid shorter and codes for a slightly different protein which will fold differently from the original protein and do something different.

A "substitution" mutation would look like this:

AUGAUUCGACGU(GAU)ACGAUCGA

Instead of the CGU amino acid, the GAU amino acid will cause the protein to fold slightly differently and do something other than what it would normally do.

Also, there's the case of introns. They're sequences in the middle of DNA or RNA molecules that do not code for a specific protein and just interrupt the sequence of the gene. (EXONS are the sequences of DNA that are actually used in coding for a protein, which I'm going to use bold letters to represent in the example)
Let's say that we converted nucleotides (the things that build up the ladders of DNA) to actual letters so we had a sentence that represents a whole gene:

The quick brown fox jumped over the lazy dog.

That's the gene without the introns. The introns would make it look like this:

ADHFDIAGJDAGJAHgThDAUFOADGHFAGKJejhdjkfhadgjijgagdAGJDOAOSD quicDHAFIAHGIDHAGADGNADAadkfjlajkAGHOAGHFHGfjioa brDNODAJGJRWAGANOFSHJHROAJGfdmkafowFHGIIAGKSDGJNfhiasdfnjasfADFHIAFHn DHAIGHDOAGAhgahofdjasfhahofoFHDIAGHdkahgxFDKJG jumpFDOGHFOAHFADFDAFJfhidoagiofaeHFdogdoiajd oFHdajoghaokgjofbgdajfhdGHdkaogver tHFojdajfodnajgbdagDFHAiffheDHFiagdijadoa lakdfaDNAKGhdkaghoagjzjdgiahgiaohgogdsy doHFiadfhafafhdighg.DHioghdojiadjfdjxmfpidmgpagnior

To my knowledge, the purpose of introns is still unknown. Rutherford says over and over that he understands that the field of genetics is a weird thing and you might as well get used to it because it's what makes us the way we are.

((I'm finally finished with my second review of 2018! I have plenty more books to review as I'm probably going to need something or other to distract me from all the random stress that comes with being in school.. But don't worry! The summer is nearly here even though there's still so much snow on the ground!! Happy Reading!!!!))